ID: 970106903

View in Genome Browser
Species Human (GRCh38)
Location 4:12595420-12595442
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970106903_970106906 8 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106906 4:12595451-12595473 CATGGCCAGAATGCTTCTTTAGG No data
970106903_970106905 -10 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106905 4:12595433-12595455 ACAGTGGCTGTGACAGATCATGG No data
970106903_970106907 11 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106907 4:12595454-12595476 GGCCAGAATGCTTCTTTAGGTGG No data
970106903_970106910 18 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG No data
970106903_970106908 12 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106908 4:12595455-12595477 GCCAGAATGCTTCTTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970106903 Original CRISPR CAGCCACTGTACTGCGCTGT GGG (reversed) Intergenic
No off target data available for this crispr