ID: 970106904

View in Genome Browser
Species Human (GRCh38)
Location 4:12595421-12595443
Sequence ACAGCCACTGTACTGCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970106904_970106908 11 Left 970106904 4:12595421-12595443 CCACAGCGCAGTACAGTGGCTGT No data
Right 970106908 4:12595455-12595477 GCCAGAATGCTTCTTTAGGTGGG No data
970106904_970106906 7 Left 970106904 4:12595421-12595443 CCACAGCGCAGTACAGTGGCTGT No data
Right 970106906 4:12595451-12595473 CATGGCCAGAATGCTTCTTTAGG No data
970106904_970106910 17 Left 970106904 4:12595421-12595443 CCACAGCGCAGTACAGTGGCTGT No data
Right 970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG No data
970106904_970106907 10 Left 970106904 4:12595421-12595443 CCACAGCGCAGTACAGTGGCTGT No data
Right 970106907 4:12595454-12595476 GGCCAGAATGCTTCTTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970106904 Original CRISPR ACAGCCACTGTACTGCGCTG TGG (reversed) Intergenic
No off target data available for this crispr