ID: 970106910

View in Genome Browser
Species Human (GRCh38)
Location 4:12595461-12595483
Sequence ATGCTTCTTTAGGTGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970106904_970106910 17 Left 970106904 4:12595421-12595443 CCACAGCGCAGTACAGTGGCTGT No data
Right 970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG No data
970106902_970106910 19 Left 970106902 4:12595419-12595441 CCCCACAGCGCAGTACAGTGGCT No data
Right 970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG No data
970106903_970106910 18 Left 970106903 4:12595420-12595442 CCCACAGCGCAGTACAGTGGCTG No data
Right 970106910 4:12595461-12595483 ATGCTTCTTTAGGTGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970106910 Original CRISPR ATGCTTCTTTAGGTGGGACC TGG Intergenic
No off target data available for this crispr