ID: 970108666

View in Genome Browser
Species Human (GRCh38)
Location 4:12613378-12613400
Sequence AGAAATAGTCTACATTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970108662_970108666 -5 Left 970108662 4:12613360-12613382 CCAATGAATGTCTATTGGAGAAA No data
Right 970108666 4:12613378-12613400 AGAAATAGTCTACATTGGGGAGG No data
970108661_970108666 -4 Left 970108661 4:12613359-12613381 CCCAATGAATGTCTATTGGAGAA No data
Right 970108666 4:12613378-12613400 AGAAATAGTCTACATTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970108666 Original CRISPR AGAAATAGTCTACATTGGGG AGG Intergenic
No off target data available for this crispr