ID: 970111631

View in Genome Browser
Species Human (GRCh38)
Location 4:12644338-12644360
Sequence AAGGTGATTCAAAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970111631_970111636 26 Left 970111631 4:12644338-12644360 CCATCTGTCCTTTGAATCACCTT No data
Right 970111636 4:12644387-12644409 TGAAAGGACTCAATAAAATGAGG No data
970111631_970111635 10 Left 970111631 4:12644338-12644360 CCATCTGTCCTTTGAATCACCTT No data
Right 970111635 4:12644371-12644393 TCTTGACAATCACATATGAAAGG No data
970111631_970111637 27 Left 970111631 4:12644338-12644360 CCATCTGTCCTTTGAATCACCTT No data
Right 970111637 4:12644388-12644410 GAAAGGACTCAATAAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970111631 Original CRISPR AAGGTGATTCAAAGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr