ID: 970114872

View in Genome Browser
Species Human (GRCh38)
Location 4:12683705-12683727
Sequence CAGAGTGAAGAAGCTATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970114868_970114872 -9 Left 970114868 4:12683691-12683713 CCAAGGTCCATGCCCAGAGTGAA No data
Right 970114872 4:12683705-12683727 CAGAGTGAAGAAGCTATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970114872 Original CRISPR CAGAGTGAAGAAGCTATAAT AGG Intergenic
No off target data available for this crispr