ID: 970116349

View in Genome Browser
Species Human (GRCh38)
Location 4:12700736-12700758
Sequence CAGCCCTGATATCTTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970116349_970116357 23 Left 970116349 4:12700736-12700758 CCCAAGGCAAGATATCAGGGCTG No data
Right 970116357 4:12700782-12700804 CTGGACCTGATCTCCTGATGGGG No data
970116349_970116353 -8 Left 970116349 4:12700736-12700758 CCCAAGGCAAGATATCAGGGCTG No data
Right 970116353 4:12700751-12700773 CAGGGCTGATATCAGGGTATTGG No data
970116349_970116354 4 Left 970116349 4:12700736-12700758 CCCAAGGCAAGATATCAGGGCTG No data
Right 970116354 4:12700763-12700785 CAGGGTATTGGTTTCTGAGCTGG No data
970116349_970116356 22 Left 970116349 4:12700736-12700758 CCCAAGGCAAGATATCAGGGCTG No data
Right 970116356 4:12700781-12700803 GCTGGACCTGATCTCCTGATGGG No data
970116349_970116355 21 Left 970116349 4:12700736-12700758 CCCAAGGCAAGATATCAGGGCTG No data
Right 970116355 4:12700780-12700802 AGCTGGACCTGATCTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970116349 Original CRISPR CAGCCCTGATATCTTGCCTT GGG (reversed) Intergenic
No off target data available for this crispr