ID: 970119457

View in Genome Browser
Species Human (GRCh38)
Location 4:12736977-12736999
Sequence AGGTTTATACAGTTAGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970119453_970119457 30 Left 970119453 4:12736924-12736946 CCCATATTTATATATGATGACTT No data
Right 970119457 4:12736977-12736999 AGGTTTATACAGTTAGTACATGG No data
970119454_970119457 29 Left 970119454 4:12736925-12736947 CCATATTTATATATGATGACTTC No data
Right 970119457 4:12736977-12736999 AGGTTTATACAGTTAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970119457 Original CRISPR AGGTTTATACAGTTAGTACA TGG Intergenic
No off target data available for this crispr