ID: 970119907

View in Genome Browser
Species Human (GRCh38)
Location 4:12741965-12741987
Sequence CTGAGGAAGTAGAATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970119907_970119909 -9 Left 970119907 4:12741965-12741987 CCTTCATTATTCTACTTCCTCAG No data
Right 970119909 4:12741979-12742001 CTTCCTCAGGCCCATATACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970119907 Original CRISPR CTGAGGAAGTAGAATAATGA AGG (reversed) Intergenic
No off target data available for this crispr