ID: 970120185

View in Genome Browser
Species Human (GRCh38)
Location 4:12745180-12745202
Sequence CTCTGGTTGGGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970120185_970120191 0 Left 970120185 4:12745180-12745202 CCTTCTTCCCTTCCCAACCAGAG No data
Right 970120191 4:12745203-12745225 ACATAATAGAAATACCAAATAGG No data
970120185_970120193 21 Left 970120185 4:12745180-12745202 CCTTCTTCCCTTCCCAACCAGAG No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970120185 Original CRISPR CTCTGGTTGGGAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr