ID: 970120185 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:12745180-12745202 |
| Sequence | CTCTGGTTGGGAAGGGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970120185_970120191 | 0 | Left | 970120185 | 4:12745180-12745202 | CCTTCTTCCCTTCCCAACCAGAG | No data | ||
| Right | 970120191 | 4:12745203-12745225 | ACATAATAGAAATACCAAATAGG | No data | ||||
| 970120185_970120193 | 21 | Left | 970120185 | 4:12745180-12745202 | CCTTCTTCCCTTCCCAACCAGAG | No data | ||
| Right | 970120193 | 4:12745224-12745246 | GGAATATATGAATAGCAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970120185 | Original CRISPR | CTCTGGTTGGGAAGGGAAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||