ID: 970120191

View in Genome Browser
Species Human (GRCh38)
Location 4:12745203-12745225
Sequence ACATAATAGAAATACCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970120186_970120191 -7 Left 970120186 4:12745187-12745209 CCCTTCCCAACCAGAGACATAAT No data
Right 970120191 4:12745203-12745225 ACATAATAGAAATACCAAATAGG No data
970120187_970120191 -8 Left 970120187 4:12745188-12745210 CCTTCCCAACCAGAGACATAATA No data
Right 970120191 4:12745203-12745225 ACATAATAGAAATACCAAATAGG No data
970120184_970120191 13 Left 970120184 4:12745167-12745189 CCACTCTCTAAGTCCTTCTTCCC No data
Right 970120191 4:12745203-12745225 ACATAATAGAAATACCAAATAGG No data
970120185_970120191 0 Left 970120185 4:12745180-12745202 CCTTCTTCCCTTCCCAACCAGAG No data
Right 970120191 4:12745203-12745225 ACATAATAGAAATACCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970120191 Original CRISPR ACATAATAGAAATACCAAAT AGG Intergenic
No off target data available for this crispr