ID: 970120193

View in Genome Browser
Species Human (GRCh38)
Location 4:12745224-12745246
Sequence GGAATATATGAATAGCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970120187_970120193 13 Left 970120187 4:12745188-12745210 CCTTCCCAACCAGAGACATAATA No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data
970120186_970120193 14 Left 970120186 4:12745187-12745209 CCCTTCCCAACCAGAGACATAAT No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data
970120185_970120193 21 Left 970120185 4:12745180-12745202 CCTTCTTCCCTTCCCAACCAGAG No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data
970120189_970120193 8 Left 970120189 4:12745193-12745215 CCAACCAGAGACATAATAGAAAT No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data
970120188_970120193 9 Left 970120188 4:12745192-12745214 CCCAACCAGAGACATAATAGAAA No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data
970120190_970120193 4 Left 970120190 4:12745197-12745219 CCAGAGACATAATAGAAATACCA No data
Right 970120193 4:12745224-12745246 GGAATATATGAATAGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970120193 Original CRISPR GGAATATATGAATAGCAAGT AGG Intergenic
No off target data available for this crispr