ID: 970122675

View in Genome Browser
Species Human (GRCh38)
Location 4:12774513-12774535
Sequence GCTATGTAGAGCCTTCGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970122672_970122675 7 Left 970122672 4:12774483-12774505 CCAGATTATCACTAACTTCATCC No data
Right 970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG No data
970122670_970122675 11 Left 970122670 4:12774479-12774501 CCTCCCAGATTATCACTAACTTC No data
Right 970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG No data
970122671_970122675 8 Left 970122671 4:12774482-12774504 CCCAGATTATCACTAACTTCATC No data
Right 970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG No data
970122669_970122675 17 Left 970122669 4:12774473-12774495 CCTGTGCCTCCCAGATTATCACT No data
Right 970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970122675 Original CRISPR GCTATGTAGAGCCTTCGGTC AGG Intergenic
No off target data available for this crispr