ID: 970123733

View in Genome Browser
Species Human (GRCh38)
Location 4:12786371-12786393
Sequence ATCAGGTAGTTGTAGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970123733_970123743 22 Left 970123733 4:12786371-12786393 CCCATGACCTACAACTACCTGAT No data
Right 970123743 4:12786416-12786438 CCTCCAAGGATTGTTTCCAGGGG No data
970123733_970123740 20 Left 970123733 4:12786371-12786393 CCCATGACCTACAACTACCTGAT No data
Right 970123740 4:12786414-12786436 ATCCTCCAAGGATTGTTTCCAGG No data
970123733_970123741 21 Left 970123733 4:12786371-12786393 CCCATGACCTACAACTACCTGAT No data
Right 970123741 4:12786415-12786437 TCCTCCAAGGATTGTTTCCAGGG No data
970123733_970123738 8 Left 970123733 4:12786371-12786393 CCCATGACCTACAACTACCTGAT No data
Right 970123738 4:12786402-12786424 TCTTCCTTCAGTATCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970123733 Original CRISPR ATCAGGTAGTTGTAGGTCAT GGG (reversed) Intergenic
No off target data available for this crispr