ID: 970123806

View in Genome Browser
Species Human (GRCh38)
Location 4:12787147-12787169
Sequence CAGAGGGTAAGGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970123806_970123814 -4 Left 970123806 4:12787147-12787169 CCATCCTCCCTCCTTACCCTCTG No data
Right 970123814 4:12787166-12787188 TCTGCAAGTGCTGGCATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970123806 Original CRISPR CAGAGGGTAAGGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr