ID: 970124371

View in Genome Browser
Species Human (GRCh38)
Location 4:12792705-12792727
Sequence CCACATGTTTTTTCCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970124367_970124371 3 Left 970124367 4:12792679-12792701 CCATCTCTCAGGTATTTTCCTCT No data
Right 970124371 4:12792705-12792727 CCACATGTTTTTTCCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970124371 Original CRISPR CCACATGTTTTTTCCCTGAA GGG Intergenic
No off target data available for this crispr