ID: 970125047

View in Genome Browser
Species Human (GRCh38)
Location 4:12799766-12799788
Sequence ACTCTAAAGGAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970125047_970125050 -2 Left 970125047 4:12799766-12799788 CCTTCCAGTTTCTCCTTTAGAGT No data
Right 970125050 4:12799787-12799809 GTGCTATTTTGTTTTTCTTTAGG No data
970125047_970125051 -1 Left 970125047 4:12799766-12799788 CCTTCCAGTTTCTCCTTTAGAGT No data
Right 970125051 4:12799788-12799810 TGCTATTTTGTTTTTCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970125047 Original CRISPR ACTCTAAAGGAGAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr