ID: 970126294

View in Genome Browser
Species Human (GRCh38)
Location 4:12815961-12815983
Sequence CAAGTACACCCCATCCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970126289_970126294 20 Left 970126289 4:12815918-12815940 CCATCACTGCCTTTCCTCAACTT No data
Right 970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG No data
970126290_970126294 11 Left 970126290 4:12815927-12815949 CCTTTCCTCAACTTCTCCAAGAA No data
Right 970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG No data
970126292_970126294 -5 Left 970126292 4:12815943-12815965 CCAAGAAAACAAGTTAACCAAGT No data
Right 970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG No data
970126291_970126294 6 Left 970126291 4:12815932-12815954 CCTCAACTTCTCCAAGAAAACAA No data
Right 970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970126294 Original CRISPR CAAGTACACCCCATCCATAG AGG Intergenic
No off target data available for this crispr