ID: 970127403

View in Genome Browser
Species Human (GRCh38)
Location 4:12830520-12830542
Sequence CACCAATACCTCAATTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970127400_970127403 -3 Left 970127400 4:12830500-12830522 CCTCTATAACCTCCAATCAGCAC No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data
970127397_970127403 22 Left 970127397 4:12830475-12830497 CCCATTTATTCACCTTACATTCT No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data
970127395_970127403 30 Left 970127395 4:12830467-12830489 CCACTGTCCCCATTTATTCACCT No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data
970127398_970127403 21 Left 970127398 4:12830476-12830498 CCATTTATTCACCTTACATTCTC No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data
970127399_970127403 10 Left 970127399 4:12830487-12830509 CCTTACATTCTCTCCTCTATAAC No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data
970127396_970127403 23 Left 970127396 4:12830474-12830496 CCCCATTTATTCACCTTACATTC No data
Right 970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970127403 Original CRISPR CACCAATACCTCAATTAGCA AGG Intergenic
No off target data available for this crispr