ID: 970129304

View in Genome Browser
Species Human (GRCh38)
Location 4:12849340-12849362
Sequence CCACTAAAACTGCTTTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970129302_970129304 17 Left 970129302 4:12849300-12849322 CCTTTTAGATATTTATTTTAGTC No data
Right 970129304 4:12849340-12849362 CCACTAAAACTGCTTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970129304 Original CRISPR CCACTAAAACTGCTTTAGCA AGG Intergenic
No off target data available for this crispr