ID: 970131462

View in Genome Browser
Species Human (GRCh38)
Location 4:12876170-12876192
Sequence CCCTGCCTGGACGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970131462_970131472 30 Left 970131462 4:12876170-12876192 CCCATGGCAACGTCCAGGCAGGG No data
Right 970131472 4:12876223-12876245 TCTTTTAGCTCTGCCATCCATGG 0: 13
1: 38
2: 89
3: 165
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970131462 Original CRISPR CCCTGCCTGGACGTTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr