ID: 970137213

View in Genome Browser
Species Human (GRCh38)
Location 4:12938011-12938033
Sequence CTAGGCTGCCTGGCAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970137213_970137219 24 Left 970137213 4:12938011-12938033 CCTTTGTCTGCCAGGCAGCCTAG No data
Right 970137219 4:12938058-12938080 TGAATCTCTTGTTCAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970137213 Original CRISPR CTAGGCTGCCTGGCAGACAA AGG (reversed) Intergenic
No off target data available for this crispr