ID: 970138171

View in Genome Browser
Species Human (GRCh38)
Location 4:12949449-12949471
Sequence ATGTAAACCCACCACTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970138171_970138172 4 Left 970138171 4:12949449-12949471 CCTGTTCAGTGGTGGGTTTACAT No data
Right 970138172 4:12949476-12949498 ACTGTTATAAATTATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970138171 Original CRISPR ATGTAAACCCACCACTGAAC AGG (reversed) Intergenic
No off target data available for this crispr