ID: 970138730

View in Genome Browser
Species Human (GRCh38)
Location 4:12956447-12956469
Sequence ATGAAGAAACAGGCTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970138730_970138733 17 Left 970138730 4:12956447-12956469 CCTTGCTGAGCCTGTTTCTTCAT No data
Right 970138733 4:12956487-12956509 TTAACCCCACAGCCTCGACTGGG No data
970138730_970138739 28 Left 970138730 4:12956447-12956469 CCTTGCTGAGCCTGTTTCTTCAT No data
Right 970138739 4:12956498-12956520 GCCTCGACTGGGGCTGAGGCTGG No data
970138730_970138732 16 Left 970138730 4:12956447-12956469 CCTTGCTGAGCCTGTTTCTTCAT No data
Right 970138732 4:12956486-12956508 TTTAACCCCACAGCCTCGACTGG No data
970138730_970138734 18 Left 970138730 4:12956447-12956469 CCTTGCTGAGCCTGTTTCTTCAT No data
Right 970138734 4:12956488-12956510 TAACCCCACAGCCTCGACTGGGG No data
970138730_970138738 24 Left 970138730 4:12956447-12956469 CCTTGCTGAGCCTGTTTCTTCAT No data
Right 970138738 4:12956494-12956516 CACAGCCTCGACTGGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970138730 Original CRISPR ATGAAGAAACAGGCTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr