ID: 970138914

View in Genome Browser
Species Human (GRCh38)
Location 4:12958479-12958501
Sequence ACTTCAGTTGGAAATTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970138914_970138919 6 Left 970138914 4:12958479-12958501 CCCCCAAAATTTCCAACTGAAGT No data
Right 970138919 4:12958508-12958530 CTTCAAATATTTATTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970138914 Original CRISPR ACTTCAGTTGGAAATTTTGG GGG (reversed) Intergenic
No off target data available for this crispr