ID: 970142721

View in Genome Browser
Species Human (GRCh38)
Location 4:12999768-12999790
Sequence CCCTGGAGAGCTCAGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970142721_970142723 -9 Left 970142721 4:12999768-12999790 CCACATCACTGAGCTCTCCAGGG No data
Right 970142723 4:12999782-12999804 TCTCCAGGGTCATGTGCTTCAGG No data
970142721_970142727 28 Left 970142721 4:12999768-12999790 CCACATCACTGAGCTCTCCAGGG No data
Right 970142727 4:12999819-12999841 AACAGCTCTACTCTTTCCTAGGG No data
970142721_970142726 27 Left 970142721 4:12999768-12999790 CCACATCACTGAGCTCTCCAGGG No data
Right 970142726 4:12999818-12999840 AAACAGCTCTACTCTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970142721 Original CRISPR CCCTGGAGAGCTCAGTGATG TGG (reversed) Intergenic
No off target data available for this crispr