ID: 970144812

View in Genome Browser
Species Human (GRCh38)
Location 4:13024336-13024358
Sequence TTCTGACTATGGGGCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970144812_970144818 5 Left 970144812 4:13024336-13024358 CCAGGGATGCCCCATAGTCAGAA No data
Right 970144818 4:13024364-13024386 TTATAGACAAAAAAGGGAAGTGG No data
970144812_970144819 27 Left 970144812 4:13024336-13024358 CCAGGGATGCCCCATAGTCAGAA No data
Right 970144819 4:13024386-13024408 GCGTACAGAAATCAGAAGTGAGG No data
970144812_970144817 -1 Left 970144812 4:13024336-13024358 CCAGGGATGCCCCATAGTCAGAA No data
Right 970144817 4:13024358-13024380 ACAAATTTATAGACAAAAAAGGG 0: 36
1: 39
2: 53
3: 192
4: 1362
970144812_970144816 -2 Left 970144812 4:13024336-13024358 CCAGGGATGCCCCATAGTCAGAA No data
Right 970144816 4:13024357-13024379 AACAAATTTATAGACAAAAAAGG 0: 39
1: 37
2: 31
3: 129
4: 1114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970144812 Original CRISPR TTCTGACTATGGGGCATCCC TGG (reversed) Intergenic
No off target data available for this crispr