ID: 970152125

View in Genome Browser
Species Human (GRCh38)
Location 4:13101112-13101134
Sequence CCAGGAGGGCTCTAGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152125_970152138 25 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152125_970152139 26 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data
970152125_970152135 20 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152125_970152137 24 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152125 Original CRISPR CCAGGAGGGCTCTAGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr