ID: 970152127

View in Genome Browser
Species Human (GRCh38)
Location 4:13101118-13101140
Sequence GGAACACCAGGAGGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152127_970152135 14 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152127_970152142 25 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data
970152127_970152137 18 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152127_970152138 19 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152127_970152139 20 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152127 Original CRISPR GGAACACCAGGAGGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr