ID: 970152128

View in Genome Browser
Species Human (GRCh38)
Location 4:13101119-13101141
Sequence GGGAACACCAGGAGGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152128_970152139 19 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data
970152128_970152137 17 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152128_970152138 18 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152128_970152142 24 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data
970152128_970152135 13 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152128 Original CRISPR GGGAACACCAGGAGGGCTCT AGG (reversed) Intergenic