ID: 970152129

View in Genome Browser
Species Human (GRCh38)
Location 4:13101126-13101148
Sequence ATGGATAGGGAACACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152129_970152138 11 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152129_970152135 6 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152129_970152137 10 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152129_970152139 12 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data
970152129_970152142 17 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152129 Original CRISPR ATGGATAGGGAACACCAGGA GGG (reversed) Intergenic