ID: 970152130

View in Genome Browser
Species Human (GRCh38)
Location 4:13101127-13101149
Sequence AATGGATAGGGAACACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152130_970152139 11 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data
970152130_970152138 10 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152130_970152137 9 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152130_970152135 5 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152130_970152142 16 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152130 Original CRISPR AATGGATAGGGAACACCAGG AGG (reversed) Intergenic