ID: 970152132

View in Genome Browser
Species Human (GRCh38)
Location 4:13101139-13101161
Sequence AAGTGGTTGTCGAATGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152132_970152139 -1 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data
970152132_970152138 -2 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152132_970152142 4 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data
970152132_970152135 -7 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152132_970152143 19 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152143 4:13101181-13101203 GGGCCAGGTTGTGTTGATAGAGG No data
970152132_970152137 -3 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152132 Original CRISPR AAGTGGTTGTCGAATGGATA GGG (reversed) Intergenic