ID: 970152134

View in Genome Browser
Species Human (GRCh38)
Location 4:13101145-13101167
Sequence GGGTGAAAGTGGTTGTCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152134_970152142 -2 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152142 4:13101166-13101188 CCTCTGACAAGGCAGGGGCCAGG No data
970152134_970152143 13 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152143 4:13101181-13101203 GGGCCAGGTTGTGTTGATAGAGG No data
970152134_970152138 -8 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152138 4:13101160-13101182 TTTCACCCTCTGACAAGGCAGGG No data
970152134_970152137 -9 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152134_970152139 -7 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152139 4:13101161-13101183 TTCACCCTCTGACAAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152134 Original CRISPR GGGTGAAAGTGGTTGTCGAA TGG (reversed) Intergenic