ID: 970152135

View in Genome Browser
Species Human (GRCh38)
Location 4:13101155-13101177
Sequence ACCACTTTCACCCTCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152125_970152135 20 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152131_970152135 2 Left 970152131 4:13101130-13101152 CCTGGTGTTCCCTATCCATTCGA No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152130_970152135 5 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152129_970152135 6 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152128_970152135 13 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152132_970152135 -7 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152127_970152135 14 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data
970152133_970152135 -8 Left 970152133 4:13101140-13101162 CCTATCCATTCGACAACCACTTT No data
Right 970152135 4:13101155-13101177 ACCACTTTCACCCTCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152135 Original CRISPR ACCACTTTCACCCTCTGACA AGG Intergenic
No off target data available for this crispr