ID: 970152137

View in Genome Browser
Species Human (GRCh38)
Location 4:13101159-13101181
Sequence CTTTCACCCTCTGACAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152133_970152137 -4 Left 970152133 4:13101140-13101162 CCTATCCATTCGACAACCACTTT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152127_970152137 18 Left 970152127 4:13101118-13101140 CCCTAGAGCCCTCCTGGTGTTCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152134_970152137 -9 Left 970152134 4:13101145-13101167 CCATTCGACAACCACTTTCACCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152125_970152137 24 Left 970152125 4:13101112-13101134 CCAGGGCCCTAGAGCCCTCCTGG No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152128_970152137 17 Left 970152128 4:13101119-13101141 CCTAGAGCCCTCCTGGTGTTCCC No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152130_970152137 9 Left 970152130 4:13101127-13101149 CCTCCTGGTGTTCCCTATCCATT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152129_970152137 10 Left 970152129 4:13101126-13101148 CCCTCCTGGTGTTCCCTATCCAT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152131_970152137 6 Left 970152131 4:13101130-13101152 CCTGGTGTTCCCTATCCATTCGA No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data
970152132_970152137 -3 Left 970152132 4:13101139-13101161 CCCTATCCATTCGACAACCACTT No data
Right 970152137 4:13101159-13101181 CTTTCACCCTCTGACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152137 Original CRISPR CTTTCACCCTCTGACAAGGC AGG Intergenic
No off target data available for this crispr