ID: 970152615

View in Genome Browser
Species Human (GRCh38)
Location 4:13105961-13105983
Sequence TCACTTCTGTTTTCTGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970152615_970152618 -3 Left 970152615 4:13105961-13105983 CCTATGGCAGAAAACAGAAGTGA No data
Right 970152618 4:13105981-13106003 TGAGCACATGAGGCCAGGTGTGG No data
970152615_970152617 -8 Left 970152615 4:13105961-13105983 CCTATGGCAGAAAACAGAAGTGA No data
Right 970152617 4:13105976-13105998 AGAAGTGAGCACATGAGGCCAGG No data
970152615_970152621 27 Left 970152615 4:13105961-13105983 CCTATGGCAGAAAACAGAAGTGA No data
Right 970152621 4:13106011-13106033 CATCTGTAATCCCAGCACTTCGG 0: 5024
1: 81336
2: 213729
3: 253622
4: 203117
970152615_970152622 28 Left 970152615 4:13105961-13105983 CCTATGGCAGAAAACAGAAGTGA No data
Right 970152622 4:13106012-13106034 ATCTGTAATCCCAGCACTTCGGG 0: 165
1: 7644
2: 97597
3: 325008
4: 286225
970152615_970152619 0 Left 970152615 4:13105961-13105983 CCTATGGCAGAAAACAGAAGTGA No data
Right 970152619 4:13105984-13106006 GCACATGAGGCCAGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970152615 Original CRISPR TCACTTCTGTTTTCTGCCAT AGG (reversed) Intergenic
No off target data available for this crispr