ID: 970155686

View in Genome Browser
Species Human (GRCh38)
Location 4:13139756-13139778
Sequence CTCTATTCACTGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155686_970155690 21 Left 970155686 4:13139756-13139778 CCCAGCTCCATCAGTGAATAGAG No data
Right 970155690 4:13139800-13139822 AATGATGCTGCCTCCTTCACAGG No data
970155686_970155691 30 Left 970155686 4:13139756-13139778 CCCAGCTCCATCAGTGAATAGAG No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155686 Original CRISPR CTCTATTCACTGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr