ID: 970155687

View in Genome Browser
Species Human (GRCh38)
Location 4:13139757-13139779
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155687_970155690 20 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155690 4:13139800-13139822 AATGATGCTGCCTCCTTCACAGG No data
970155687_970155691 29 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data
970155687_970155693 30 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155687 Original CRISPR GCTCTATTCACTGATGGAGC TGG (reversed) Intergenic
No off target data available for this crispr