ID: 970155689

View in Genome Browser
Species Human (GRCh38)
Location 4:13139789-13139811
Sequence GGCAGCATCATTTGTTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155689_970155693 -2 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data
970155689_970155699 29 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155699 4:13139841-13139863 ACTGCCTCCTCCCCTTCTCTGGG No data
970155689_970155698 28 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155698 4:13139840-13139862 TACTGCCTCCTCCCCTTCTCTGG No data
970155689_970155691 -3 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155689 Original CRISPR GGCAGCATCATTTGTTTTTT AGG (reversed) Intergenic
No off target data available for this crispr