ID: 970155690

View in Genome Browser
Species Human (GRCh38)
Location 4:13139800-13139822
Sequence AATGATGCTGCCTCCTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155688_970155690 14 Left 970155688 4:13139763-13139785 CCATCAGTGAATAGAGCTAATTT No data
Right 970155690 4:13139800-13139822 AATGATGCTGCCTCCTTCACAGG No data
970155687_970155690 20 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155690 4:13139800-13139822 AATGATGCTGCCTCCTTCACAGG No data
970155686_970155690 21 Left 970155686 4:13139756-13139778 CCCAGCTCCATCAGTGAATAGAG No data
Right 970155690 4:13139800-13139822 AATGATGCTGCCTCCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155690 Original CRISPR AATGATGCTGCCTCCTTCAC AGG Intergenic
No off target data available for this crispr