ID: 970155691

View in Genome Browser
Species Human (GRCh38)
Location 4:13139809-13139831
Sequence GCCTCCTTCACAGGAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155686_970155691 30 Left 970155686 4:13139756-13139778 CCCAGCTCCATCAGTGAATAGAG No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data
970155689_970155691 -3 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data
970155688_970155691 23 Left 970155688 4:13139763-13139785 CCATCAGTGAATAGAGCTAATTT No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data
970155687_970155691 29 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155691 Original CRISPR GCCTCCTTCACAGGAGCACA AGG Intergenic
No off target data available for this crispr