ID: 970155693

View in Genome Browser
Species Human (GRCh38)
Location 4:13139810-13139832
Sequence CCTCCTTCACAGGAGCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155687_970155693 30 Left 970155687 4:13139757-13139779 CCAGCTCCATCAGTGAATAGAGC No data
Right 970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data
970155689_970155693 -2 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data
970155688_970155693 24 Left 970155688 4:13139763-13139785 CCATCAGTGAATAGAGCTAATTT No data
Right 970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155693 Original CRISPR CCTCCTTCACAGGAGCACAA GGG Intergenic
No off target data available for this crispr