ID: 970155699

View in Genome Browser
Species Human (GRCh38)
Location 4:13139841-13139863
Sequence ACTGCCTCCTCCCCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970155689_970155699 29 Left 970155689 4:13139789-13139811 CCTAAAAAACAAATGATGCTGCC No data
Right 970155699 4:13139841-13139863 ACTGCCTCCTCCCCTTCTCTGGG No data
970155694_970155699 5 Left 970155694 4:13139813-13139835 CCTTCACAGGAGCACAAGGGACC No data
Right 970155699 4:13139841-13139863 ACTGCCTCCTCCCCTTCTCTGGG No data
970155692_970155699 8 Left 970155692 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG No data
Right 970155699 4:13139841-13139863 ACTGCCTCCTCCCCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970155699 Original CRISPR ACTGCCTCCTCCCCTTCTCT GGG Intergenic
No off target data available for this crispr