ID: 970157068

View in Genome Browser
Species Human (GRCh38)
Location 4:13152324-13152346
Sequence GCTCAAATGTCACCATATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970157068_970157069 10 Left 970157068 4:13152324-13152346 CCTGGATATGGTGACATTTGAGC No data
Right 970157069 4:13152357-13152379 AAGAAATCAAAGAGCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970157068 Original CRISPR GCTCAAATGTCACCATATCC AGG (reversed) Intergenic
No off target data available for this crispr