ID: 970159097

View in Genome Browser
Species Human (GRCh38)
Location 4:13171302-13171324
Sequence CAGATGTGGTAGTAGAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970159089_970159097 28 Left 970159089 4:13171251-13171273 CCTCTTTAGCTTCCAGACTCTAG No data
Right 970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG No data
970159094_970159097 4 Left 970159094 4:13171275-13171297 CCAACTCTAGGCCTGTGGACACA No data
Right 970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG No data
970159090_970159097 16 Left 970159090 4:13171263-13171285 CCAGACTCTAGCCCAACTCTAGG No data
Right 970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG No data
970159095_970159097 -7 Left 970159095 4:13171286-13171308 CCTGTGGACACAGTCACAGATGT No data
Right 970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG No data
970159093_970159097 5 Left 970159093 4:13171274-13171296 CCCAACTCTAGGCCTGTGGACAC No data
Right 970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970159097 Original CRISPR CAGATGTGGTAGTAGAGCCC CGG Intergenic
No off target data available for this crispr