ID: 970160384

View in Genome Browser
Species Human (GRCh38)
Location 4:13182317-13182339
Sequence AGTGACTCAGTTCCAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970160374_970160384 24 Left 970160374 4:13182270-13182292 CCATGAGGTAGAGTTTAGTTCCC No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160378_970160384 3 Left 970160378 4:13182291-13182313 CCCTCCCCTTGAGTGTGGCTGGA No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160381_970160384 -2 Left 970160381 4:13182296-13182318 CCCTTGAGTGTGGCTGGACTTAG No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160380_970160384 -1 Left 970160380 4:13182295-13182317 CCCCTTGAGTGTGGCTGGACTTA No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160379_970160384 2 Left 970160379 4:13182292-13182314 CCTCCCCTTGAGTGTGGCTGGAC No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160382_970160384 -3 Left 970160382 4:13182297-13182319 CCTTGAGTGTGGCTGGACTTAGT No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data
970160376_970160384 4 Left 970160376 4:13182290-13182312 CCCCTCCCCTTGAGTGTGGCTGG No data
Right 970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970160384 Original CRISPR AGTGACTCAGTTCCAAGGAA TGG Intergenic
No off target data available for this crispr