ID: 970162440

View in Genome Browser
Species Human (GRCh38)
Location 4:13202556-13202578
Sequence GTGATGCTTTTGCCTCTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970162440_970162443 2 Left 970162440 4:13202556-13202578 CCCGCTAGAGGCAAAAGCATCAC No data
Right 970162443 4:13202581-13202603 TGTCAAGATCAAAGCTCAGAGGG No data
970162440_970162444 3 Left 970162440 4:13202556-13202578 CCCGCTAGAGGCAAAAGCATCAC No data
Right 970162444 4:13202582-13202604 GTCAAGATCAAAGCTCAGAGGGG No data
970162440_970162446 28 Left 970162440 4:13202556-13202578 CCCGCTAGAGGCAAAAGCATCAC No data
Right 970162446 4:13202607-13202629 AGAAGACCAGATATTCTCCTGGG No data
970162440_970162442 1 Left 970162440 4:13202556-13202578 CCCGCTAGAGGCAAAAGCATCAC No data
Right 970162442 4:13202580-13202602 CTGTCAAGATCAAAGCTCAGAGG No data
970162440_970162445 27 Left 970162440 4:13202556-13202578 CCCGCTAGAGGCAAAAGCATCAC No data
Right 970162445 4:13202606-13202628 GAGAAGACCAGATATTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970162440 Original CRISPR GTGATGCTTTTGCCTCTAGC GGG (reversed) Intergenic
No off target data available for this crispr