ID: 970166092

View in Genome Browser
Species Human (GRCh38)
Location 4:13240077-13240099
Sequence TGACCTTTCCTCAGTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970166092_970166095 1 Left 970166092 4:13240077-13240099 CCTCAAGCACTGAGGAAAGGTCA No data
Right 970166095 4:13240101-13240123 GTGAGGACACAGTGAGAAGGTGG 0: 94
1: 312
2: 755
3: 1249
4: 1851
970166092_970166096 17 Left 970166092 4:13240077-13240099 CCTCAAGCACTGAGGAAAGGTCA No data
Right 970166096 4:13240117-13240139 AAGGTGGCTGTCTGCAAGACAGG No data
970166092_970166094 -2 Left 970166092 4:13240077-13240099 CCTCAAGCACTGAGGAAAGGTCA No data
Right 970166094 4:13240098-13240120 CATGTGAGGACACAGTGAGAAGG 0: 199
1: 615
2: 1451
3: 2266
4: 2994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970166092 Original CRISPR TGACCTTTCCTCAGTGCTTG AGG (reversed) Intergenic
No off target data available for this crispr