ID: 970166231

View in Genome Browser
Species Human (GRCh38)
Location 4:13241270-13241292
Sequence CATTCTAAGGAGAAGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970166231_970166237 13 Left 970166231 4:13241270-13241292 CCTTGCTTCTTCTCCTTAGAATG No data
Right 970166237 4:13241306-13241328 CCTGCTTTCCTGGCCCAGAAAGG No data
970166231_970166233 3 Left 970166231 4:13241270-13241292 CCTTGCTTCTTCTCCTTAGAATG No data
Right 970166233 4:13241296-13241318 TCAGCCAAGCCCTGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970166231 Original CRISPR CATTCTAAGGAGAAGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr